July, 2017

now browsing by month

 

To identify specific region of SNP using bioinformatics tools

How could i identify the specific region of the SNP using bioinformatics tools?

I have done a PCR and amplified a region of a gene and have sequenced the same region. I have done RFLP with the product and there are specific cuts as well, so how can i identify the exact region in the sequence. My work is on a Human gene 740 bp size.

there are many tools but BLAST searching will give you the exact location in the genome and also similar sequences

define residue terminal in gromacs

How to define residue terminals (preceeing and following residues) in gromacs modified residue forcefield?

In Gromacs 5.x.x, When am using a modified force field parameterized for modified amino acid the proceeding residue and the following residues are added with their carboxyl (COOH) and amino (NH3) terminals considering as the end of the sequence.

determining the termini with “-ter” flag in pdb2gmx reporting there was a “jiggling bond in the structure”.

I cross checked the initial structure- its fine and joined.

How to solve this issue?

Answer:

The modified force-field is most likely the problem. Would it be possible to attach the snapshot of the screen when run pdb2gmx ?My best guess modified residue is not being recognized as a valid protein residue. If you haven’t have done it already, make a copy residuetype.dat in your working directory, not force-field directory ( I am assuming you are using charmm) and make an entry for modified residue and then try to parameterize again. I hope it will work.

Add 4 nucleotides (TATA) to the 3′ end chain C with UCSF Chimera

Question :How can I add 4 nucleotides (TATA) to the 3′ end of 1JJ4|Chain C with UCSF Chimera?

This should be relatively simple. 1JJ4 i the PDB has the sequences

>1JJ4:C|PDBID|CHAIN|SEQUENCE
CAACCGAATTCGGTTG
>1JJ4:D|PDBID|CHAIN|SEQUENCE
CAACCGAATTCGGTTG

It’s missing the P97 promoter TATA at the 3′ end such that I need a model with this sequence as there may be a Proline residue in the C terminus that binds and provides steric hindrance at the P97 promoter.

I’ve tried using the Build Structure tool without success. Here is the 1JJ4 sequence with the TATA box appended at the 3′ end.

>HPV18|E8^E2BS|DNA

CAACCGAATTCGGTTGTATA

Answer:

X3DNA: http://x3dna.org/

How to align a gene sequence to a genomic sequence?

Question : How do I align a gene sequence to a genomic sequence?

I have whole genome sequence data for a mutant. I wish to align a gene sequence to the whole genome sequence to check for potential SNPs. Clustal W fails to upload the sequence properly. I have downloaded Clustal W, that also crashes when I try to load the whole genome sequence as a profile in pair wise alignment.

I have also tried multiple sequence alignemnt tools on EBI. They took forever to load the genome sequence.

My genome sequence is a paired-end sequence. I had concatenated both reads on Galaxy and am using FASTA file of the concatenated reads.

Is there a mistake in what I am doing? Can anyone suggest me any other way?

Answers:
Maybe you can try BWA (http://bio-bwa.sourceforge.net/) or Bowtie (http://bowtie-bio.sourceforge.net/manual.shtml).

It works well for my SNPs detection in RADseq

Based on your description, I think you have not assembled your sequence data. To begin with, you should perform de novo assembly on your raw sequence reads using SPades assembler for example with careful option (Galaxy might have this tool available). Once you have your draft genome, you can then perform a blastn alignment of your gene of interest to identify for the presence of any variant nucleotides. Hope that helps.

compiling xmipp-3.1

Hi,
when compiling xmipp-3.1 on my old laptop under ubuntu-16.04 I get
the error message, in ./build/hdf5-1.8.10_make.log:

…………………..
CC H5make_libsettings.o
CCLD H5make_libsettings
LD_LIBRARY_PATH=”$LD_LIBRARY_PATH`echo | \
sed -e ‘s/-L/:/g’ -e ‘s/ //g’`” \
./H5make_libsettings > H5lib_settings.c ||
\
(test $HDF5_Make_Ignore && echo “*** Error ignored”) || \
(rm -f H5lib_settings.c ; exit 1)
…………………………..

and, further down:
……………………………
LD_LIBRARY_PATH=”$LD_LIBRARY_PATH`echo | \
sed -e ‘s/-L/:/g’ -e ‘s/ //g’`” \
./H5detect > H5Tinit.c || \
(test $HDF5_Make_Ignore && echo “*** Error ignored”) || \
(rm -f H5Tinit.c ; exit 1)
……………………………..

and at the end:

……………………………..

th5s.c: In function ‘test_h5s_zero_dim’:
th5s.c:733:9: error: C++ style comments are not allowed in ISO C90
// ret = H5Pset_alloc_time(plist_id, alloc_time);
^
th5s.c:733:9: error: (this will be reported only once per input file)
Makefile:1249: die Regel für Ziel „th5s.o“ scheiterte
make[1]: *** [th5s.o] Fehler 1
make[1]: Verzeichnis
„/home/blaas/Downloads/xmipp/external/hdf5-1.8.10/test“ wir
d verlassen
Makefile:539: die Regel für Ziel „all-recursive“ scheiterte
make: *** [all-recursive] Fehler 1
………………………………….

what can be the reason?
Thank you!
Dieter


Dr. Dieter Blaas
Max F. Perutz Laboratories,
Inst. Med. Biochem.,
Med. Univ. Vienna
Dr. Bohr Gasse 9/3
A-1030 Vienna, Austria
Tel. 0043 1 4277 61630
Fax 0043 1 4277 9616

——————————————————————————
_______________________________________________

Roberto Marabini roberto@cnb.csic.es via lists.sourceforge.net
9/14/16

to Blaas, newxmipp-users
Dear Dieter,

Regarding the last error you may change the line

// ret = H5Pset_alloc_time(plist_id, alloc_time);

by

/* ret = H5Pset_alloc_time(plist_id, alloc_time); */

“//” comments are not allowed in old (pre 99) C compilers, use “/* */” instead.

Regarding the first two errors I do not think they are errors.

hope this helps

Roberto Marabini roberto@cnb.csic.es via lists.sourceforge.net
9/15/16

to Blaas, newxmipp-users
It seems like you are missing a few dependencies. Let us focus in one
of the error files (the one related with numpy)

Numpy is developed in a mix of Python, C and Fortan for speed. You
need the python header files, a fortran compiler, gcc and the
BLAS/LAPACK libraries.

On Ubuntu this are the dependencies, maybe you can infer what to
install from here:

python 2.7
libblas3
liblapack3
gcc
gfortran
python-dev (python header files)
libc6

Nevertheless my recommendation is do not try to install xmipp and use
Scipion instead (http://scipion.cnb.csic.es/m/home/). Scipion will
install the latest version of xmipp for you and will provide a much
nicer interface.

Roberto

On Thu, Sep 15, 2016 at 6:03 AM, Blaas Dieter
wrote:
> Dear Roberto,
> I made these changes in h5dump-ddl.c, th5s.c, and h5tools_str.c and the
> error went away. However, I am still having a number of error messages
> (mostly referring to missing files – see attached logs), which apparently
> prevent building of the executables…
> What can I do?
> Thanks, best, Dieter

to Roberto, newxmipp-users
Hi Roberto,

thanks for your hints! I now installed Scipion from GIT and it
compiled without any problem!

Best, Dieter

————————————————————————
Dieter Blaas,
Max F. Perutz Laboratories
Medical University of Vienna,
Inst. Med. Biochem., Vienna Biocenter (VBC),
Dr. Bohr Gasse 9/3,
A-1030 Vienna, Austria,
Tel: 0043 1 4277 61630,
Fax: 0043 1 4277 9616,
e-mail: dieter.blaas@meduniwien.ac.at
————————————————————————

simulated annealing

Hi Roberto,

I wanted to use simulated annealing from an apparently correct scipion
installation (no errors issued during compilation and configure) but
when I run either:

scipion xmipp_volume_initial_simulated_annealing –gui

or:

xmipp_volume_initial_simulated_annealing –gui

I always get:

/usr/bin/env: xmipp_python: No such file or directory

Should xmipp_python not be installed automatically? It is not in
../xmipp/bin/ where it was in the older versions and I can neither find
it anywhere else!

Thanks for hints, best wishes, Dieter

————————————————————————
Dieter Blaas,
Max F. Perutz Laboratories
Medical University of Vienna,
Inst. Med. Biochem., Vienna Biocenter (VBC),
Dr. Bohr Gasse 9/3,
A-1030 Vienna, Austria,
Tel: 0043 1 4277 61630,
Fax: 0043 1 4277 9616,
e-mail: dieter.blaas@meduniwien.ac.at
————————————————————————

——————————————————————————
Check out the vibrant tech community on one of the world’s most
engaging tech sites, Slashdot.org! http://sdm.link/slashdot
_______________________________________________

Dear Dieter,

simulated annealing was an attempt we did to solve the initial volume
through common lines. The code is still useful for programming purposes
but not for regular usage. We recommend you to use Ransac or
Reconstruct_significant that are the two programs for initial volume
currently supported by Xmipp. The easiest access is through Scipion.

Kind regards, Carlos Oscar

© 2018: Biocuration | GREEN EYE Theme by: D5 Creation | Powered by: WordPress